Some problems with use of DNA analysis for forensic evidence may occur because ofidentical twins.

not enough of a sample.

contaminated samples.

degraded samples.

All of the above.

Answers

Answer 1
Answer:

Answer: Option D " all of the above "

Explanation: DNA can be a great source of information when used as a forensic evidence. This technique has many advantages and disadvantages when used as a source of information in case of crime.

Identical twins: There are some common fragments of DNA that is same in identical twins so it can be a difficulty in deciding the criminal.

Not enough of a sample: DNA should be present in a detectable amount to be used an sample for evidence, less than this detectable amount is a waste and cannot be used as a sample for evidence.

Contaminated and degraded sample: If the sample of DNA is contaminated or degraded then the result might be incorrect and might not be used as a sample for forensic evidence.

Hence, the correct answers are all of the above.


Related Questions

According to the lock and key model of enzymes, which of the following would be the most likely substrate?a. V b. X c. Y d. Z e. A realistic substrate is not shown in the diagram.
Describe how an allosteric enzyme works.
Which of the following statements correctly describes why a series of closely spaced action potentials causes a sustained contraction rather than a series of closely spaced twitches?a. Ca2+ ions are released quickly from troponin, keeping the Ca2+ concentration in the cytosol high between closely spaced action potentials.b. Release of Ca2+ from the sarcoplasmic reticulum through channels is slow compared to the uptake of Ca2+ into the SR via ATP-dependent pumps, resulting in Ca2+ slowly trickling into the sarcomeres between closely spaced action potentials.c. When a series of action potentials is closely spaced, there is not sufficient time for Ca2+ uptake into the sarcoplasmic reticulum between action potentials, and Ca2+ remains bound to troponin throughout the series.d. Fewer Ca2+ ions are released from the sarcoplasmic reticulum as a result of several closely spaced action potentials than as a result of a single action potential.
A nucleic acid molecules is a type
The inside of red blood cells is 300 mosm. what will happen to your red blood cells if you become dehydrated and your blood osmolarity increases to 350 mosm?

Why lenses in a microscope is important. essay

Answers

Answer:

So you can see what is on the glass slide

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode and sequence the DNA. After entering your sequence into BOLD the following comparison comes up.Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAASpecies 2. ATGCAAATTTTTTGGGCATCCGAATGGCAAWhat DNA modifications have occurred in Species 2 that makes it different from Species 1? Check all that apply.a. Inversionb. Duplicationc. Deletion

Answers

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

How many different ways does/could energy change form during its travels between the Sun and your stomach?

Answers

Energy will take the path from sun to stomach as sun's energy to chemical energy followed by thermal and mechanical energy.

Explanation:

The energy of the sun is in the from of chemical energy which is the ultimate basis of life on earth . The process of photosynthesis occurs to form a chemical compound named glucose. The food ingested is in polymer complex forms as protein, carbohydrate, fats etc which is broken into monomers for absorption in intestine and stomach.

The dietary compound has energy stored in their bonds as chemical energy.

So, from sun human consume chemical energy which is stored in food.

The energy even if consumed by eating meat is also chemical energy which is stored as potential energy.

The breakdown of food or chemical energy into monomers leads to release of thermal energy or heat to maintain optimum body temperature.

Chemical energy also gets converted to mechanical energy which allows functioning of vital organs and movement of body.

Azotobacter A. forms endospores. B. forms cysts. C. fixes carbon dioxide. D. are used as an indicator of fecal pollution.

Answers

Answer: Azotobacter forms cysts. The answer is, “B.”

You want to make 50 ml of 1X tricaine solution in order to euthanize some fish. How much of a 20X tricaine stock solution will you need to dilute in order to make your solution?a. 1 ml b. 5 ml c. 0.4 ml d. 10 ml e. 2.5 ml

Answers

Answer: e. 2.5 ml

Explanation:

According to the dilution law,

C_1V_1=C_2V_2

where,

C_1 = concentration of stock solution = 20X

V_1 = volume of stock solution = ?

C_2 = concentration of required solution= 1X

V_2 = volume of  required solution= 50 ml

20* V_1=1* 50ml

V_2=2.5ml

Thus 2.5 ml much of a 20X tricaine stock solution is needed to dilute in order to make your solution.

Which three organization levels are in a human stomach?Muti choice
1) cell
2)organ
3)organ system
4)organism
5)tissue

Answers

Answer:

Cell, tissue, and organ.

Explanation:

A cell is an obvious one because it makes up the tissue, and it is needed in order to form an organ. Meaning tissue and cell would have to be included. Tissues witch are made of many cells form an organ, and an organ would be  the human stomach/digestive system. It can't be organ system because a stomach can't be a whole system including the heart and ect. It can't be organism because a stomach isn't enough organ systems to create an organism.

Answer:

Cell Organ System Organ

Explanation:

cells make up everything as a building block of life.